Noble Research Institute | VIGS Database | |||||
VIGS Phenomics and Functional Genomics Database | |||||
Phenotype Description | |||
---|---|---|---|
Stunted, bushy plants, pale green leaves, mottled, crinckled top leaves | |||
Annotation | |||
Solyc01g095000.2.1;genomic_reference:SL2.50ch01 gene_region:78136105-78137562 transcript_region:SL2.50ch01:78136105..78137562- functional_description:"Homology to unknown gene (AHRD V1 *-*- Q019E6_OSTTA)" | |||
ref|NP_182134.2|;Nuclear transport factor 2 family protein [Arabidopsis thaliana]gb|AAT41772.1| At2g46100 [Arabidopsis thaliana]gb|AAT70469.1| At2g46100 [Arabidopsis thaliana]gb|AEC10643.1| Nuclear transport factor 2 (NTF2) family protein [Arabidopsis thaliana] | |||
NbS00031783g0007.1;protein AED:0.04 eAED:0.04 QI:74|1|1|1|1|1|4|684|252; (*GB) gi|297745341|emb|CBI40421.3| (e_value=8e-107) unnamed protein product [Vitis vinifera];; (*TAIR) AT2G46100.1 (e_value=3e-96) | Symbols: | Nuclear transport factor 2 (NTF2) family protein | chr2:18953326-18954467 FORWARD LENGTH=240;; (*ITAG) Solyc01g095000.2.1 (e_value=4e-140) genomic_reference:SL2.40ch01 gene_region:78136105-78137562 transcript_region:SL2.40ch01:78136105..78137562- functional_description:"Homology to unknown gene (AHRD V1 *-*- Q019E6_OSTTA)"; | |||
AT2G46100.1;| Symbols: | Nuclear transport factor 2 (NTF2) family protein | chr2:18953326-18954467 FORWARD LENGTH=240 | |||
GO ID (Nr annotation) | |||
GO:0016301 GO:0016310 | |||
GO ID (Arabidopsis annotation) | |||
GO:0000786 GO:0005634 GO:0003677 GO:0000012 GO:0006337 GO:0006338 GO:0006342 GO:0007290 GO:0030317 | |||
GO ID (Tomato annotation) | |||
GO:0005819 GO:0016605 GO:0035189 GO:0001047 GO:0001102 GO:0019900 GO:0031625 GO:0042802 GO:0051219 GO:0006351 GO:0006469 GO:0007050 GO:0007265 GO:0007283 GO:0016568 GO:0031134 GO:0031175 GO:0034088 GO:0034349 GO:0035914 GO:0042551 GO:0043353 GO:0043550 GO:0045445 GO:0045651 GO:0045842 GO:0045879 GO:0045944 GO:0048565 GO:0048667 GO:0050680 GO:0051146 GO:0051301 GO:0051402 GO:0071459 GO:0071466 GO:0071922 GO:0071930 GO:0097284 GO:1903944 GO:2000134 | |||
GO ID (Niben annotation) | |||
Sequence | |||
>NbTI01A05AATTGTGACAGGCTTTGAGGTTCCTGTTGATTGTTCTGGTCGAGCCGTTCGTGTAGCTGTCGTGGACTCGATTAAACAAGACTTTAAACGATCCTACTTC |
4-1:1A1-1D12 [6-20-12]//1A5b-2.JPG |